rs13393767 chr2:38654732 A>C
- Sequence
ttgcacgtgccccaggagcccagg[A/C]aaaggctctgctgaaaagacttcc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NR2C1_HUMAN MGAP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | -0.17 | 2.29 | 2.00 | n/a | No Hit | |||
| MGAP_HUMAN | n/a | 1.58 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg