rs16871186 chr6:11271759 T>C
- Sequence
gcttcattcattggggaagtggta[T/C]gtcatccattccaaggttttgact
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.06 | -0.10 | 1.31 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP docetaxel response in lymphoblastoid cell lines, fasting insulin, homa-b, homa-ir, ldl cholesterol, total cholesterol, triglycerides change with statins