rs16902043 chr8:127219700 A>G
- Sequence
agaaggactaaaaatcatagacct[A/G]tagcaaattaaatgattatagaga
- ASB in cell types
- CFPAC-1(pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CFPAC-1(pancreatic ductal adenocarcinoma) | -1.30 | 1.97 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol change with statins, transmission distortion