rs16953429 chr17:3723522 G>A
- Sequence
ttcagcgctcacctcggcccaagc[G/A]aagctccagcgggagcaattgaga
- ASB in cell types
- primary B-CLL cells MCF-7 C4-12 (invasive breast ductal carcinoma)
- ASB for transcription factors
- ZFX_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 1.84 | -1.52 | 1.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.52 | 0.72 | 1.08 | 0.00 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Muscle_Skeletal, Testis