rs16983293 chr20:62847704 A>G
- Sequence
aggccctccagtggccatgttcaa[A/G]aacagaatgaaaatccgtatgtag
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -2.23 | 1.10 | 1.33 | |||
| HEK293 (embryonic kidney) | -0.01 | 1.00 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting blood glucose, microalbuminuria, resistance to kuru in aged women despite likely exposure, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg