rs17097481 chr5:141708122 T>C
- Sequence
ggaagcagaggaaggacaggctcc[T/C]tgaggctcggtcgggccctgggcc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MTG16_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG16_HUMAN | 2.98 | -5.32 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, cystatin c in serum, fasting insulin, hdl cholesterol, homa-ir, late onset alzheimers disease, rheumatoid arthritis, suicide attempts in bipolar disorder, suicide attempts in mood disorder patients, systolic blood pressure (sbp), transmission distortion