rs55923152 chr10:79068848 A>G
- Sequence
ggcggcggcgcggcgcggcgctcc[A/G]ctccggcctgactccgcaccggct
- ASB in cell types
- fetal bone marrow-derived mononuclear cells MDA-MB-231 (breast adenocarcinoma) GM12878 (female B-cells lymphoblastoid cell line) Peyer's patch
- ASB for transcription factors
- KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | n/a | 3.94 | 2.00 | 2.93 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Nerve_Tibial, Pituitary