rs55962605 chr13:31074971 G>T
- Sequence
gattatacaagagaacctggcact[G/T]cctcctctctcttgcttcctctct
- ASB in cell types
- monocyte-derived dendritic cells GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- SPI1_HUMAN ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.07 | 2.34 | 1.70 | 7.28 | Concordant | |||
| ELF1_HUMAN | n/a | 3.14 | 1.00 | 5.53 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
