rs56041749 chr15:88042266 G>A
- Sequence
tttactgtctcataaaaagaggct[G/A]gtcctcagaggcaaacaaaagaaa
- ASB in cell types
- LNCaP95 LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP95 | -0.15 | 2.15 | 3.00 | |||
| LNCaP (prostate carcinoma) | 0.17 | 0.61 | 1.51 |
Items per page:
1 – 2 of 2