rs56076781 chr18:12038914 A>T
- Sequence
gggaccaagcgggcccgccctggg[A/T]gcctgagctttctcctcactctca
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.72 | 1.67 | 1.83 | |||
| HEK293 (embryonic kidney) | 0.28 | 1.00 | 2.06 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood