rs56130943 chr14:105440185 A>C
- Sequence
cagggcctgcccgcctgcagagca[A/C]ggccacttgggtactgccggaatg
- ASB for transcription factors
- PAX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PAX2_HUMAN | -1.55 | 1.95 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood