rs18582 chr1:85329136 A>G
- Sequence
atgtccggaggtgactacaaagca[A/G]aagcatggaatgtcatacattcca
- ASB in cell types
- HAEC (human aortic endothelial cells) HepG2 (hepatoblastoma)
- ASB for transcription factors
- JUN_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.91 | -0.42 | 1.75 | n/a | No Hit | |||
| TF65_HUMAN | 2.25 | -3.25 | 1.83 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, biploar disorder (bipolar schizoaffective disorder), hdl cholesterol, ldl cholesterol, neuroblastoma (brain cancer), stabilized warfarin dose, tardive dyskinesia, urinary albumin-to-creatinine ratio
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood