rs487081 chr1:119674766 G>A
- Sequence
atgatcatccatagaagataccag[G/A]ttaaataaatcatgatacaataga
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN CEBPB_HUMAN RING2_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.52 | -0.67 | 1.87 | n/a | No Hit | |||
| CEBPB_HUMAN | 1.78 | -1.68 | 1.33 | n/a | No Hit | |||
| RING2_HUMAN | 1.92 | -1.95 | 1.33 | n/a | n/a | |||
| ARI1B_HUMAN | 1.84 | -1.73 | 1.33 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), hdl cholesterol, microalbuminuria, obesity with early age of onset (age >2), systolic blood pressure (sbp), total cholesterol
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis