rs6645 chr12:14774891 C>G
- Sequence
cgccgccctcagggagctggctcc[C/G]ccagcaaaggcccttttcatggtc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -1.02 | 1.37 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis