rs1000039 chr10:10515910 G>T
- Sequence
ggatgatgtcacttaattggcaac[G/T]tttttcttgcttagtcataaatga
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCASMC (Human coronary artery smooth muscle cells) | 1.29 | -0.55 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-beta 2 glycoprotein i antibodies (anti-b2gpi), cystatin c in serum, ldl cholesterol change with statins, maternal transmission distortion, transmission distortion