rs1000457 chr17:35346409 C>T
- Sequence
caccaccggcgctaccacttccac[C/T]ttggcaagtgaagccccactacaa
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived dendritic cells macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.17 | 2.87 | 2.50 | |||
| monocyte-derived dendritic cells | -4.75 | 2.65 | 2.00 | |||
| macrophages form periferal blood | 2.85 | 0.78 | 2.00 |
Items per page:
1 – 3 of 3