rs1001930 chr1:209653448 A>G
- Sequence
cactctttcccccaggttagggtc[A/G]gagagcttttagggaaacctggag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.35 | 0.86 | 1.12 | |||
| 22RV1 (prostate carcinoma) | 2.27 | -1.33 | 2.00 |
Items per page:
1 – 2 of 2