rs1002091 chr4:156972019 C>G
- Sequence
aggggcagccctgggacgcgtccg[C/G]gcgagcgggcttggccgcccactg
- ASB in cell types
- erythroid cells foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.34 | n/a | 2.00 | |||
| foreskin keratinocyte | -3.77 | 1.24 | 2.00 |
Items per page:
1 – 2 of 2