rs1002422 chr12:27635541 A>G
- Sequence
aaaagcaacaggatttacagcagt[A/G]tttgaccggaagtgccatctagtg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.16 | -0.24 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 0.53 | -0.52 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.03 | -0.26 | 1.00 |
Items per page:
1 – 3 of 3