rs1002922 chr5:40386453 T>C
- Sequence
gcctctagggtttctctacatctg[T/C]ggttgtagttctctaagtgtggtc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MV-4-11 (Childhood acute monocytic leukemia)
- ASB for transcription factors
- CDK9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | -0.35 | 1.14 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, comorbid depressive syndrome and alcohol dependence, crohns disease, eye color, irritible bowel syndrome, multiple sclerosis (females), obesity with early age of onset (age >2), primary rhegmatogenous retinal detachment, triglycerides