rs1003316 chr8:133503691 A>T
- Sequence
gctccaccctaggccttatcgtta[A/T]caaggactttcctgaatatctcca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- SOX6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SOX6_HUMAN | -5.32 | 3.14 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), major depressive disorder, serum creatinine