rs1003986 chr3:85821213 G>T
- Sequence
gtcttgttcagcctcagaatccca[G/T]atagcaagacaagaaagctttgct
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.81 | 2.20 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, body mass index (bmi), eye color, microalbuminuria, obesity with early age of onset (age >2), schizophrenia, severe diabetic retinopathy, spine bone mineral density (bmd)