rs1004222 chr1:224700930 G>A
- Sequence
ttctgcagaggtgccacttgctga[G/A]tagggccaaagtcatgtaattatt
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.00 | 1.48 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), mitral annular calcium