rs1005328 chr19:28466147 G>A
- Sequence
gctgttagtgtgtacacactcaag[G/A]aaactatagaaggagatggatatg
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma) K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- ZN512_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN512_HUMAN | n/a | 2.96 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1