rs1005968 chr10:114703675 C>T
- Sequence
gtcatcttcaacgcctccaatgca[C/T]ctggtctgtgctccacacattaca
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 0.96 | -0.73 | 1.00 | |||
| A549 (lung carcinoma) | 0.93 | 0.22 | 2.00 |
Items per page:
1 – 2 of 2