rs1006409 chr12:29282742 A>G
- Sequence
catctgcttccttcttttcctttt[A/G]tggtatgcatagatatcacatctg
- ASB in cell types
- MOLT3 (adult T acute lymphoblastic leukemia) SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- TAL1_HUMAN ERG_HUMAN CDK9_HUMAN GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 2.33 | -4.24 | 1.50 | 0.79 | Weak Discordant | |||
| ERG_HUMAN | -2.13 | 2.27 | 1.00 | n/a | No Hit | |||
| CDK9_HUMAN | 1.53 | -1.34 | 1.50 | n/a | n/a | |||
| GATA2_HUMAN | -1.19 | 1.39 | 1.50 | 0.30 | Weak Concordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, comorbid depressive syndrome and alcohol dependence, ldl cholesterol change with statins, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), total cholesterol change with statins, triglycerides