rs1006514 chr7:28921704 G>A
- Sequence
gtggcatgttagccccttattaac[G/A]cccatcattttgtatgctcctgtc
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.12 | -1.78 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, alzheimers disease, arthritis including non-rheumatoid, asthma, college completion, intracranial aneurysm, longstanding arthritis, serum creatinine, sporadic creutzfeldt-jakob disease