rs1006615 chr9:130433393 C>T
- Sequence
gcaggactgcggcacgggcggccc[C/T]tctacgctgcagtaccggctgctg
- ASB in cell types
- CUTLL1 (T-cell lymphoblastic lymphoma 1) GM02630 (Fanconi anemi) MS-1 (Small cell lung carcinoma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | n/a | 4.10 | 2.00 | |||
| GM02630 (Fanconi anemi) | 2.66 | -2.36 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -1.57 | 1.88 | 1.00 | |||
| erythroid progenitors | 2.37 | -4.60 | 2.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -1.44 | 1.78 | 1.00 |
Items per page:
1 – 5 of 6