rs1007841 chr14:68691411 A>C
- Sequence
ctcctcttctctttctctgcctcc[A/C]ataaagccggagaattaacccagg
- ASB in cell types
- primary human epidermal keratinocytes
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -2.24 | 2.36 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, homa-b, resistance to kuru in aged women despite likely exposure, transmission distortion, waist hip ratio