rs1008461 chr6:13218317 C>T
- Sequence
gatgggtcacagtgatttcctact[C/T]atcagcctgtaccgtggaatggag
- ASB in cell types
- HUES64 (embryonic stem cells)
- ASB for transcription factors
- GATA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA4_HUMAN | -1.79 | 2.23 | 1.00 | 4.21 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, premature ovarian failure, sporadic creutzfeldt-jakob disease, total cholesterol