rs1008526 chr17:72316657 A>T
- Sequence
ttgcagttcagctatgccttgtgg[A/T]ttctcagataatacatgttagagg
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | -1.85 | 2.15 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-b, homa-ir, ldl cholesterol, ldl cholesterol change with statins, rheumatoid arthritis, total cholesterol, total cholesterol change with statins