rs1008599 chr7:142338955 A>G
- Sequence
tccagagttaaacacaaactcccc[A/G]ctaccagagaagagtagaggtgct
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.19 | -4.13 | 2.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Colon_Transverse, Esophagus_Mucosa, Lung, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood