rs1008949 chr8:22696108 T>C
- Sequence
cactcccaactggaggagacggcc[T/C]ctctcccaacacttttcggcacgc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.17 | n/a | 1.00 | |||
| K562 (myelogenous leukemia) | 0.65 | 0.07 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, fasting insulin, height, homa-b, homa-ir, schizophrenia, triglycerides change with statins, waist hip ratio