rs1009145 chr14:68938736 T>C
- Sequence
agcaaaacagccagcaagataccc[T/C]ggacacatcaggagcccagtcaat
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.09 | 0.99 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | n/a | 1.96 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), college completion, hdl cholesterol change with statins, neuroticism, simpson-angus scale, tardive dyskinesia, years of education
GTEx eQTL Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid