rs1009173 chr11:58654116 A>G
- Sequence
ataaaatacaagtcttctttagtg[A/G]tgagcagttgattttattctggaa
- ASB in cell types
- neural cell A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.19 | -0.22 | 1.00 | |||
| A549 (lung carcinoma) | 0.14 | 0.92 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Testis, Thyroid