rs1009528 chr7:4416673 A>C
- Sequence
gatatctctaccgtaatgttcctg[A/C]taaacacgcatccggtttctgttg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.44 | 0.68 | 1.24 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), microalbuminuria, systolic blood pressure (sbp), years of education