rs1009862 chr12:76037358 T>C
- Sequence
ttataatgagtgcttagcgctttt[T/C]tttaactgtagtacaaacacaatt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.04 | 0.81 | 1.41 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.30 | 0.88 | 1.50 |
Items per page:
1 – 2 of 2