rs1010167 chr1:109656105 C>G
- Sequence
ggcgaggccgagcccctcctagtg[C/G]ttccggaccttgctccctgaacac
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia) MS-1 (Small cell lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line) gastroesophageal sphincter
- ASB for transcription factors
- CTCF_HUMAN ELF1_HUMAN ERG_HUMAN GABP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.09 | 2.14 | 1.29 | 3.79 | Concordant | |||
| ELF1_HUMAN | 2.11 | -0.33 | 1.06 | -2.66 | Concordant | |||
| ERG_HUMAN | 1.80 | -0.61 | 1.28 | -3.67 | Concordant | |||
| GABP1_HUMAN | 2.13 | -1.87 | 1.00 | n/a | n/a | |||
| GCR_HUMAN | 1.80 | -0.24 | 1.25 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood