rs1010591 chr20:4041763 T>A
- Sequence
cagtctgggaggtggactgacgag[T/A]gttgggggctctcagagaccagga
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.09 | 0.86 | 2.08 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg, Thyroid