rs1010693 chr19:46009925 G>T
- Sequence
gtgtttcccaagatggccacaagg[G/T]ggcgccctccaccctttggaacca
- ASB in cell types
- WA09 (embryonic stem cells) A549 (lung carcinoma) HeLa Kyoto (cervical adenocarcinoma) stomach
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.84 | 0.34 | 1.25 | |||
| A549 (lung carcinoma) | 0.82 | 1.08 | 1.17 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 1.32 | -0.21 | 2.00 | |||
| stomach | 2.54 | -2.26 | 1.00 |
Items per page:
1 – 4 of 4