rs1012003 chr19:47658874 T>C
- Sequence
ttgcttcccttagctgcatttttt[T/C]cccctgaattcgaagcctgcttcg
- ASB in cell types
- 22RV1 (prostate carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- ANDR_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.31 | -1.54 | 2.00 | n/a | No Hit | |||
| TF65_HUMAN | 1.97 | -0.42 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, late onset alzheimers disease, parkinsons disease, parkinsons disease (pd), stabilized warfarin dose, triglycerides