rs1012175 chr6:164749365 A>G
- Sequence
ggaaagcttcccagatgctaatct[A/G]taagtctttccaaatagcacctca
- ASB in cell types
- ARP-1(Plasma cell myeloma)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -2.11 | 2.90 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, comorbid depressive syndrome and alcohol dependence, late onset alzheimers disease