rs1012411 chr6:30364778 T>G
- Sequence
gctccacagagtggcatctacagg[T/G]catagttgtcagtgactcagggag
- ASB in cell types
- foreskin keratinocyte VCaP (prostate carcinoma) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 2.33 | 3.00 | |||
| VCaP (prostate carcinoma) | -3.13 | 1.84 | 1.50 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 1.31 | -1.15 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP idiopathic membranous nephropathy, irritible bowel syndrome, rheumatoid arthritis, triglycerides, type 1 diabetes, type 1 diabetes, rheumatoid arthritis, combined case analysis, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Vagina, Whole_Blood