rs1012850 chr11:123479129 G>A
- Sequence
aaaaacgtgctgcatggaagggaa[G/A]gagaaagggattccgtacacagtg
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | n/a | 3.35 | 2.00 | 3.42 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), ldl cholesterol change with statins, systolic blood pressure (sbp), total cholesterol change with statins