rs1013044 chr20:10240396 C>T
- Sequence
gtgattgggagccttaattataca[C/T]gcaggatccatttacgtttcccta
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 2.14 | -0.46 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, ldl cholesterol, ldl cholesterol change with statins, obesity with early age of onset (age >2), simpson-angus scale, total cholesterol change with statins, years of education