rs1013128 chr21:39126088 G>A
- Sequence
gcatcaggtcacaatgaactcgca[G/A]catggataggaaaggcccaagtcc
- ASB in cell types
- neutrophils from periferal blood K562 (myelogenous leukemia) GM19193 (female B-cells Lymphoblastoid Cell Lines) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -4.76 | 2.87 | 1.50 | |||
| K562 (myelogenous leukemia) | 0.76 | 0.43 | 1.10 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.30 | -0.37 | 1.00 | |||
| LNCaP (prostate carcinoma) | -3.22 | 1.30 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg