rs1013687 chr7:26399402 A>G
- Sequence
cgctcctggggttggttttcctga[A/G]cctctgtagctgtgctgctcactg
- ASB in cell types
- LNCaP (prostate carcinoma) adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -1.09 | 1.81 | 1.00 | |||
| adrenal gland | -1.85 | 2.24 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Lung, Pancreas, Testis