rs10150005 chr14:65227538 T>C
- Sequence
ggtgtgttccaatttctcagggcc[T/C]gcccttccatggtaacctgttccc
- ASB in cell types
- ESO-26 (Gastroesophageal junction adenocarcinoma)
- ASB for transcription factors
- KLF5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KLF5_HUMAN | -2.02 | 2.46 | 1.00 | 3.21 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
