rs10151119 chr14:50123160 G>A
- Sequence
cagcctgaaggaggtaagggagca[G/A]gctgtgaggctaaatggctgaaaa
- ASB in cell types
- neural cell
- ASB for transcription factors
- ZIC2_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | -4.40 | 3.10 | 1.33 | n/a | No Hit | |||
| EP300_HUMAN | -2.34 | 2.72 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol, obesity with early age of onset (age >2), prop taste detection threshold, total cholesterol, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood