rs10152591 chr15:69755818 A>C
- Sequence
ctaatccagagaaacagtttcaag[A/C]ctggtggttcaccccagccttgtt
- ASB in cell types
- CFPAC-1(pancreatic ductal adenocarcinoma) Th1-cells
- ASB for transcription factors
- FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | -0.81 | 1.49 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abnormal findings on exam of gastrointestinal tract/abdominal area, abnormal tumor markers, elevated cea or ca 125, adverse effects of sedatives or other central nervous system depressants and anesthetics, anal and rectal polyp, aneurysm and dissection of heart, ankylosing spondylitis, chronic prostatitis, chronic renal failure, cns infection and poliomyelitis, degenerative disease of the spinal cord, diseases of esophagus, diseases of sebaceous glands, disturbance of skin sensation, endocarditis, esophagitis, gerd and related diseases, exophthalmos, gastritis and duodenitis, graves disease, heartburn, hypertensive chronic kidney disease, hypertensive heart and/or renal disease, iatrogenic hypothyroidism, inflammation of the eye, inguinal hernia, keratoconjunctivitis, noninfectious, known or suspected fetal abnormality, lack of normal physiological development, lung involvement in conditions classified elsewhere, mixed hyperlipidemia, musculoskeletal symptoms referable to limbs, nerve root lesions, other conditions of brain, other sprains and strains, otosclerosis, pain in joint, postmenopausal atrophic vaginitis, proteinuria, renal dialysis, renal failure, respiratory abnormalities, rheumatoid arthritis & related inflammatory polyarthropathies, sebaceous cyst, spondylosis without myelopathy, sprains and strains, stricture of artery, type 2 diabetic nephropathy, unequal leg length (acquired), unspecified erythematous condition